My ChemCD       document.write('Login'); | Register

Current position: Home >SiteMap > Chemicals
A  | B  | C  | D  | E  | F  | G  | H  | I  | J  | K  | L  | M  | N  | O  | P  | Q  | R  | S  | T  | U  | V  | W  | X  | Y  | Z  | 1  | 2  | 3  | 4  | 5  | 6  | 7  | 8  | 9 
CAS No.  Product Name Formula
  GLOBULIN, BETA, BOVINE, FRACTION III
126689-79-0   GLYCINE, N-(3-METHYLPHENYL)-, METHYL ESTER C10 H13 N O2
131770-73-5   GLYCINE, N-(4-PHENOXYPHENYL)-, METHYL ESTER C15 H15 N O3
  GLC MODEL MIXTURE REFERENCE STANDARD 4A
  GLC MODEL MIXTURE REFERENCE STANDARD 5C
  GALANIN RECEPTOR TYPE 1 (HUMAN)
  GANGLIOSIDE AMMONIUM SALT, BOVINE
  GANGLIOSIDE GT1B, TRISIALO, TRIAMMONIUM SALT, BOVINE
65988-71-8   GD2-GANGLIOSIDE
  GELATIN VERONAL BUFFER-EDTA
8002-60-6 ;84696-15-1   GINGER OLEORESIN
  GLOBO-N-TETRAOSE GEL
  GLOBOTRIOSE-GEL
  GLOBOTRIOSE-APE-HSA
  GLUTATHIONE S-TRANSFERASE A1-1, HUMAN, RECOMBINANT
  GLUTATHIONE S-TRANSFERASE M1-1, HUMAN, RECOMBINANT
  GLUTATHIONE S-TRANSFERASE P1-1, HUMAN, RECOMBINANT
  GP100
  GRB2 SH2-DOMAIN PROTEIN A FUSION PROTEIN
64522-98-1   GT1A-GANGLIOSIDE
568-76-3   GAMMA-HYDROXYPHENYLBUTAZONE C19 H20 N2 O3
19293-86-8   GL 205 C17 H22 N4 O2 . 2 Br
17303-67-2   GONIOTHALAMIN C13 H12 O2
6379-55-1   GRIFOLIN C16 H28 O2
144376-63-6   GLISOPRENIN B C45 H82 O6
  GGTI-297 C26 H31 N3 O3 S
191102-79-1   GGTI-2133 C27 H26 N4 O3
  GENOMIC DNA LIBRARY, HUMAN (PERIPHERAL BLOOD, MALE AND FEMALE)
  GERANYL GERANYL CYSTEINE
  GERBU ADJUVANT MM
  GLA-DOMAINLESS FACTOR X (HUMAN)
  GLASSFOG(R)
56996-62-4   GLOKILL 77
  GLUCOCEREBROSIDE, [GLUCOSYL CERAMIDE, (STEAROYL-1-14C)]
  GLYCERRHIZA GLABRA EXTRACT
  GOTU KOLA
  GRAM STAIN FOR FILMS
  GREEN MARKING DYE
  GS96 BROTH
  GUGILOL COMMIPHORA MUKUL EXTRACT
  GGAGCTGTCGTATTCCAGTC
  GLY-GLY-TYR-ARG ACOH 2H2O C19H33N7O8
  GANCICLOVIR, [8-14C] C9 H13 N5 O4
  GLYCERALDEHYDE, [1-14C] C3 H6 O3
  GADOLINIUM FERRITE 3 Fe O2 . Gd
251293-28-4   GLU-THR-PRO-ASP-CYS-PHE-TRP-LYS-TYR-CYS-VAL (HYDROCHLORIDE FORM) C64H88ClN13O18S2
  GIANT CELL TUMOR, GRADE I-II TISSUE SECTIONS, HUMAN
  GLOMUS TUMOR TISSUE SECTIONS, HUMAN
  GST-UBC5A (E2), HUMAN
  GST-UBCH5B (E2), HUMAN
  GGACK-UPA
  GERMAN SILVER Ge . Ni
685506-42-7   GSK 264220A C17 H21 N3 O4 S
170905-75-6   GM 1489 C27 H33 N3 O4
  GM 6001, NEGATIVE CONTROL C23 H34 N4 O4
  GTTAAATTGCTAACGCAGTCA
  GALACTOSYL CERAMIDE, [GALACTOSE-6-3H] C48 H92 N O8 T
  GERANYL GERANYL CYSTEINE, [1-3H] C23 H38 N O2 S T
  G-SUBTIDE C53 H96 N22 O15
  GENOMIC DNA LIBRARIES DROSOPHILA VIRILIS
76746-56-0   GINNALIN A C20 H20 O13
  GADOLINIUM ALUMINUM OXIDE
  GADOLINIUM PHOSPHATE
  GADOLINIUM SCANDIUM GALLIUM OXIDE
  GAMMA1/GAMMA1/CD45 ISOTYPE CONTROL
  GAMMA-LITHIUM ALUMINATE
  GC III ELUTION SOLUTION
  GENECLEAN GLASSMILK
  GENECLEAN II GLASSMILK
  GENECLEAN III LABEL BLOCK
  GENECLEAN III TBE MODIFIER
  GENECLEAN III WASH CONCENTRATE
  GENECLEAN II TBE MODIFIER
  GENECLEAN II WASH CONCENTRATE
  GENECLEAN WASH CONCENTRATE
  GENESHUTTLE(TM)
  GEMCITABINE, [5-3H]- C9 H10 F2 N3 O4 T
  GERMAN MEASLES HPV-77
106441-42-3   GARDENIABLUE
12002-43-6   GILSONITE
< Pre 1 2 3 4 5 ... 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 ... 50 Next >
About Us - Services - Careers - Friendly Link - Contact Us - Links - Help Center - Disclaimer - Add to favorite
SiteMap | Product SiteMap | CAS | CAS Index
Copyright © 2012-2014, chemcd.com.License: ICP NO.:Zhejiang ICP 11020424 No. -1